eRAM

encyclopedia of Rare Disease Annotation for Precision Medicine

HOME
QUERY
- DISEASE
- GENOTYPE
NETWORK
- PHENOTYPE
- GENE
- COMMON
- DISEASE PAIR
DOWNLOAD
SUBMIT CASE
HELP&FAQ
- HELP&FAQ
- CONTACT US


	hereditary chronic pancreatitis

Disease ID	844
Disease	hereditary chronic pancreatitis
Definition	A disorder characterized by recurrent episodes of pancreatitis that start at a young age. It is caused by mutations in the PRSS1 or SPINK1 genes. Patients are at a high risk of developing pancreatic carcinoma.
Synonym	familial chronic pancreatitis familial chronic pancreatitis (disorder) familial pancreatitis hereditary pancreatitis hereditary pancreatitis (disorder) hp hpc pancreatitis, hereditary pctt
Orphanet	ORPHANET:676
OMIM	OMIM:167800
UMLS	C0238339
SNOMED-CT	SNOMEDCT_US_2016_09_01:235956004;SNOMEDCT_US_2016_09_01:68072000
Comorbidity	UMLS \| Disease \| Sentences' Count(Total Sentences:1) C0235974 \| pancreatic cancer \| 1
Curated Gene	Entrez_id \| Symbol \| Resource(Total Genes:6) 11330 \| CTRC \| CLINVAR;UNIPROT 1080 \| CFTR \| CLINVAR;UNIPROT 6690 \| SPINK1 \| CLINVAR;UNIPROT 5967 \| REG1A \| UNIPROT 5644 \| PRSS1 \| CLINVAR;UNIPROT 5645 \| PRSS2 \| UNIPROT
Inferring Gene	(Waiting for update.)
Text Mined Gene	(Waiting for update.)
Locus	Symbol \| Locus(Total Locus:6) PRSS1 \| 7q34 CFTR \| 7q31.2 CTRC \| 1p36.21 PRSS2 \| 7q34 SPINK1 \| 5q32 CPA1 \| 7q32.2

Disease ID	844
Disease	hereditary chronic pancreatitis
Integrated Phenotype	HPO \| Name(Total Integrated Phenotypes:17) HP:0001738 \| Exocrine pancreatic insufficiency HP:0002570 \| Steatorrhea HP:0001974 \| Leukocytosis HP:0005206 \| Pancreatic pseudocyst HP:0002202 \| Pleural effusion HP:0012379 \| Abnormal enzyme/coenzyme activity HP:0001977 \| Abnormal thrombosis HP:0005213 \| Pancreatic calcification HP:0001733 \| Pancreatic inflammation HP:0005213 \| Pancreatic calcifications HP:0100027 \| Recurrent pancreatitis HP:0000819 \| Diabetes mellitus HP:0002027 \| Abdominal pain HP:0011227 \| Elevated C-reactive protein level HP:0001945 \| Fever HP:0030247 \| Splanchnic vein thrombosis HP:0000952 \| Jaundice
Text Mined Phenotype	HPO \| Name \| Sentences' Count(Total Phenotypes:1) HP:0002894 \| Neoplasia of the pancreas \| 1

Disease ID	844
Disease	hereditary chronic pancreatitis
Manually Symptom	(Waiting for update.)
Text Mined Symptom	UMLS \| Name \| Sentences' Count(Total Symptoms:1) C0235974 \| pancreatic cancer \| 1

Manually Genotype(Total Manually Genotypes:1)
Gene	Mutation	DOI	Article Title
PRSS1	p.N29I	doi:10.1038/gim.2015.123	Expanded genetic screening panel for the Ashkenazi Jewish population

Text Mining Genotype(Total Genotypes:0)
(Waiting for update.)

All Snps(Total Genotypes:106)
snpId	pubmedId	geneId	geneSymbol	diseaseId	sourceId	sentence	score	Year	geneSymbol_dbSNP	CHROMOSOME	POS	REF	ALT
rs1042522	24289637	7157	TP53	umls:C0238339	BeFree	In conclusions, p53 Arg72Pro polymorphism is a potential marker of HP infection-related HNSCC rather than a susceptibility gene polymorphism.	0.000542884	2014	TP53	17	7676154	G	T,C
rs104893938	NA	6690	SPINK1	umls:C0238339	CLINVAR	NA	0.244885954	NA	SPINK1	5	147831576	A	G
rs104893939	NA	6690	SPINK1	umls:C0238339	CLINVAR	NA	0.244885954	NA	SPINK1	5	147831537	A	G,C
rs111033564	14695529	5644	PRSS1	umls:C0238339	UNIPROT	To challenge this notion, here we describe the unique properties of the E79K cationic trypsinogen mutation (c.235G>A), which was identified in three European families affected by sporadic or familial pancreatitis cases.	0.268229955	2004	PRSS1	7	142751808	G	A
rs111033565	11866271	5644	PRSS1	umls:C0238339	BeFree	The R122H and N291 mutations of CT are the most common disease-associated mutations in HP; the N34S mutation of SPINK I is the most frequent genetic risk factor associated with IP.	0.268229955	2002	PRSS1	7	142751938	G	A
rs111033565	12408512	6690	SPINK1	umls:C0238339	BeFree	Ever since the discovery that in most patients with hereditary pancreatitis a mutation in the gene encoding for cationic trypsinogen (R122H) was found that results in a gain of trypsin function', many other mutations in the cationic trypsinogen gene, as well as in the gene encoding for pancreatic secretory trypsin inhibitor, have been found in patients with chronic pancreatitis.	0.244885954	2002	PRSS1	7	142751938	G	A
rs111033565	10909845	5644	PRSS1	umls:C0238339	BeFree	Two heterozygous missense mutations, R122H (R117H) and N29I (N21I), in the cationic trypsinogen gene have been clearly associated with HP.	0.268229955	2000	PRSS1	7	142751938	G	A
rs111033565	17069643	5644	PRSS1	umls:C0238339	BeFree	The R122H mutation of the cationic trypsinogen was found in patients with hereditary pancreatitis.	0.268229955	2006	PRSS1	7	142751938	G	A
rs111033565	19287144	5644	PRSS1	umls:C0238339	BeFree	In 1996, shortly after a locus for hereditary pancreatitis had been mapped to chromosome 7q35, an apparent gain-of-function missense mutation, p.R122H, in the cationic trypsinogen gene (PRSS1) was identified.	0.268229955	2008	PRSS1	7	142751938	G	A
rs111033565	12508340	5644	PRSS1	umls:C0238339	BeFree	The majority of patients with hereditary pancreatitis express one of two mutations (R122H or N29I) in the cationic trypsinogen gene (PRSS1 gene).	0.268229955	2003	PRSS1	7	142751938	G	A
rs111033565	18702646	5644	PRSS1	umls:C0238339	BeFree	The R122H mutation represents the most common point mutation of the cationic trypsinogen gene (PRSS1) in patients with hereditary pancreatitis (HP; Online Mendelian inheritance in man [OMIM] 167800), a rare variety of chronic pancreatitis.	0.268229955	2008	PRSS1	7	142751938	G	A
rs111033565	15028953	5644	PRSS1	umls:C0238339	BeFree	Based on these findings, we revised the criteria for the diagnosis of HP; (1) recurrent acute or chronic pancreatitis with R122H or N29I mutation of the CT gene, or (2) recurrent acute or chronic pancreatitis with a family history of 2 or more affected patients, irrespective of generation, with at least 1 of the patients having no known etiological factors, and in case of siblings only, the onset of the disease in at least 1 of the patients is under age 40 years.	0.268229955	2004	PRSS1	7	142751938	G	A
rs111033565	11866271	6690	SPINK1	umls:C0238339	BeFree	The R122H and N291 mutations of CT are the most common disease-associated mutations in HP; the N34S mutation of SPINK I is the most frequent genetic risk factor associated with IP.	0.244885954	2002	PRSS1	7	142751938	G	A
rs111033565	11702203	5644	PRSS1	umls:C0238339	BeFree	Since the identification in 1996 of a gain of function missense mutation, R122H, in the cationic trypsinogen gene (PRSS1) as a cause of hereditary pancreatitis, continued screening of this gene in both hereditary and sporadic pancreatitis has found more disease-associated missense mutations than expected.	0.268229955	2001	PRSS1	7	142751938	G	A
rs111033565	16358943	5644	PRSS1	umls:C0238339	BeFree	The most common mutations in hereditary pancreatitis are R122H, N29I and A16V but many families have been described with clinically defined hereditary pancreatitis where there is no PRSS1 mutation.	0.268229955	2005	PRSS1	7	142751938	G	A
rs111033565	11874252	5644	PRSS1	umls:C0238339	BeFree	An R122H mutation in the cationic trypsinogen gene was identified in this patient, his brother, and his mother, indicating that they have hereditary pancreatitis.	0.268229955	2001	PRSS1	7	142751938	G	A
rs111033565	23474566	5644	PRSS1	umls:C0238339	BeFree	Hereditary pancreatitis is typically caused by the PRSS1 R122H or N29I mutations resulting in high penetrance (about 80%) autosomal dominant disorder that is usually reported in North America, Northern Europe and Northeast Asia, but not South America, Africa or India.	0.268229955	2013	PRSS1	7	142751938	G	A
rs111033565	11788572	5644	PRSS1	umls:C0238339	BeFree	Hereditary pancreatitis (HP) is usually caused by mutations in the cationic trypsinogen (PRSS1) gene, especially R122H or N29I.	0.268229955	2002	PRSS1	7	142751938	G	A
rs111033565	11729110	5644	PRSS1	umls:C0238339	BeFree	Nine subjects had the N34S PSTI mutation and 1 had hereditary pancreatitis (R122H, PRSS1).	0.268229955	2001	PRSS1	7	142751938	G	A
rs111033565	11932257	5644	PRSS1	umls:C0238339	BeFree	Finally, cathepsin B- catalyzed activation of recombinant human cationic trypsinogen with hereditary pancreatitis-associated mutations N29I, N29T, or R122H were characterized.	0.268229955	2002	PRSS1	7	142751938	G	A
rs111033565	12408512	5644	PRSS1	umls:C0238339	BeFree	Ever since the discovery that in most patients with hereditary pancreatitis a mutation in the gene encoding for cationic trypsinogen (R122H) was found that results in a gain of trypsin function', many other mutations in the cationic trypsinogen gene, as well as in the gene encoding for pancreatic secretory trypsin inhibitor, have been found in patients with chronic pancreatitis.	0.268229955	2002	PRSS1	7	142751938	G	A
rs111033565	11260229	5644	PRSS1	umls:C0238339	BeFree	Among the known PRSS1 mutations, only the R122H was detected in a single subject and the A16V in two subjects in the cohort, strengthening that HP-associated PRSS1 mutations are rare in ICP.	0.268229955	2001	PRSS1	7	142751938	G	A
rs111033566	10909845	5644	PRSS1	umls:C0238339	BeFree	Two heterozygous missense mutations, R122H (R117H) and N29I (N21I), in the cationic trypsinogen gene have been clearly associated with HP.	0.268229955	2000	PRSS1	7	142750600	A	C,T
rs111033566	11788572	5644	PRSS1	umls:C0238339	BeFree	Hereditary pancreatitis (HP) is usually caused by mutations in the cationic trypsinogen (PRSS1) gene, especially R122H or N29I.	0.268229955	2002	PRSS1	7	142750600	A	C,T
rs111033566	21952138	5644	PRSS1	umls:C0238339	BeFree	We believe that interaction between the novel IVS3+172 intronic variant and p.N29I mutation in the PRSS1 gene is associated with HP in this Malaysian Chinese family.	0.268229955	2011	PRSS1	7	142750600	A	C,T
rs111033566	16358943	5644	PRSS1	umls:C0238339	BeFree	The most common mutations in hereditary pancreatitis are R122H, N29I and A16V but many families have been described with clinically defined hereditary pancreatitis where there is no PRSS1 mutation.	0.268229955	2005	PRSS1	7	142750600	A	C,T
rs111033566	11932257	5644	PRSS1	umls:C0238339	BeFree	Finally, cathepsin B- catalyzed activation of recombinant human cationic trypsinogen with hereditary pancreatitis-associated mutations N29I, N29T, or R122H were characterized.	0.268229955	2002	PRSS1	7	142750600	A	C,T
rs111033566	23474566	5644	PRSS1	umls:C0238339	BeFree	Hereditary pancreatitis is typically caused by the PRSS1 R122H or N29I mutations resulting in high penetrance (about 80%) autosomal dominant disorder that is usually reported in North America, Northern Europe and Northeast Asia, but not South America, Africa or India.	0.268229955	2013	PRSS1	7	142750600	A	C,T
rs111033566	12508340	5644	PRSS1	umls:C0238339	BeFree	The majority of patients with hereditary pancreatitis express one of two mutations (R122H or N29I) in the cationic trypsinogen gene (PRSS1 gene).	0.268229955	2003	PRSS1	7	142750600	A	C,T
rs111033566	15028953	5644	PRSS1	umls:C0238339	BeFree	Based on these findings, we revised the criteria for the diagnosis of HP; (1) recurrent acute or chronic pancreatitis with R122H or N29I mutation of the CT gene, or (2) recurrent acute or chronic pancreatitis with a family history of 2 or more affected patients, irrespective of generation, with at least 1 of the patients having no known etiological factors, and in case of siblings only, the onset of the disease in at least 1 of the patients is under age 40 years.	0.268229955	2004	PRSS1	7	142750600	A	C,T
rs111033568	11719509	5644	PRSS1	umls:C0238339	BeFree	Here we report a family with hereditary pancreatitis that carries a novel PRSS1 mutation (R122C).	0.268229955	2002	PRSS1	7	142751937	C	T
rs111033568	19454815	5644	PRSS1	umls:C0238339	BeFree	Hereditary pancreatitis: clinical features and inheritance characteristics of the R122C mutation in the cationic trypsinogen gene (PRSS1) in six Spanish families.	0.268229955	2009	PRSS1	7	142751937	C	T
rs111966833	NA	6690	SPINK1	umls:C0238339	CLINVAR	NA	0.244885954	NA	SPINK1	5	147828053	G	A,C
rs113993959	NA	1080	CFTR	umls:C0238339	CLINVAR	NA	0.121085767	NA	CFTR	7	117587778	G	T
rs113993960	NA	1080	CFTR	umls:C0238339	CLINVAR	NA	0.121085767	NA	CFTR	7	117559592	CTT	-
rs11540654	24289637	7157	TP53	umls:C0238339	BeFree	In conclusions, p53 Arg72Pro polymorphism is a potential marker of HP infection-related HNSCC rather than a susceptibility gene polymorphism.	0.000542884	2014	TP53	17	7676040	C	T,G,A
rs11554495	16327287	3856	KRT8	umls:C0238339	BeFree	We found the heterozygous G62C mutation in n = 3/80 patients (n = 2/52 patients from different families, 3.8%) with familial pancreatitis without PRSS1 mutation and in n = 3/126 patients (2.4%) with sporadic pancreatitis.	0.000271442	2006	KRT8	12	52904798	C	A
rs115545701	NA	1080	CFTR	umls:C0238339	CLINVAR	NA	0.121085767	NA	CFTR	7	117509089	C	T
rs11971167	NA	1080	CFTR	umls:C0238339	CLINVAR	NA	0.121085767	NA	CFTR	7	117642528	G	A,T
rs121909293	NA	11330	CTRC	umls:C0238339	CLINVAR	NA	0.241357209	NA	CTRC	1	15445717	C	T
rs121909293	22942235	11330	CTRC	umls:C0238339	UNIPROT	Comprehensive functional analysis of chymotrypsin C (CTRC) variants reveals distinct loss-of-function mechanisms associated with pancreatitis risk.	0.241357209	2013	CTRC	1	15445717	C	T
rs121909294	NA	11330	CTRC	umls:C0238339	CLINVAR	NA	0.241357209	NA	CTRC	1	15440524	G	A,T
rs140993290	22942235	11330	CTRC	umls:C0238339	UNIPROT	Comprehensive functional analysis of chymotrypsin C (CTRC) variants reveals distinct loss-of-function mechanisms associated with pancreatitis risk.	0.241357209	2013	CTRC	1	15445660	G	A
rs141115171	10653140	5644	PRSS1	umls:C0238339	BeFree	However, neither the R117H nor the N21L mutation in the cationic trypsinogen were found in the HP family with the L327R alteration in CFTR.	0.268229955	2000	CFTR	7	117540210	T	G
rs142560329	22942235	11330	CTRC	umls:C0238339	UNIPROT	Comprehensive functional analysis of chymotrypsin C (CTRC) variants reveals distinct loss-of-function mechanisms associated with pancreatitis risk.	0.241357209	2013	CTRC	1	15445703	C	T
rs148954387	NA	6690	SPINK1	umls:C0238339	CLINVAR	NA	0.244885954	NA	SPINK1	5	147828020	A	G
rs17107315	24210198	6690	SPINK1	umls:C0238339	BeFree	Four patients had hereditary pancreatitis (three with confirmed N34S mutation in the SPINK1 gene), one patient had chronic pancreatitis of unknown etiology, and one patient with annular pancreas developed obstructive chronic pancreatitis.	0.244885954	2013	SPINK1	5	147828115	T	C
rs17107315	11866271	5644	PRSS1	umls:C0238339	BeFree	The R122H and N291 mutations of CT are the most common disease-associated mutations in HP; the N34S mutation of SPINK I is the most frequent genetic risk factor associated with IP.	0.268229955	2002	SPINK1	5	147828115	T	C
rs17107315	11866271	6690	SPINK1	umls:C0238339	BeFree	The R122H and N291 mutations of CT are the most common disease-associated mutations in HP; the N34S mutation of SPINK I is the most frequent genetic risk factor associated with IP.	0.244885954	2002	SPINK1	5	147828115	T	C
rs17107315	NA	6690	SPINK1	umls:C0238339	CLINVAR	NA	0.244885954	NA	SPINK1	5	147828115	T	C
rs17107315	23698120	6690	SPINK1	umls:C0238339	BeFree	Using recombinant normal sequence PSTI/tumor-associated trypsin inhibitor (TATI), a variant associated with familial pancreatitis (N34S), an active site-inactivated variant (R18/V19), and immunoneutralization and RNA interference-mediated knockdown techniques, we investigated the actions of PSTI/TATI on cell migration (wounding monolayers), collagen invasion (gel invasion assays), and proliferation (Alamar blue) on 253J, RT4, and HT1376 human bladder carcinoma cell lines.	0.244885954	2013	SPINK1	5	147828115	T	C
rs17107315	10691414	6690	SPINK1	umls:C0238339	UNIPROT	Mutational analysis of the human pancreatic secretory trypsin inhibitor (PSTI) gene in hereditary and sporadic chronic pancreatitis.	0.244885954	2000	SPINK1	5	147828115	T	C
rs1799977	16963262	4292	MLH1	umls:C0238339	BeFree	Second, the samples from Finnish hereditary prostate cancer (HPC) families were used for the screening of MLH1 mutations which produced twelve MLH1 sequence variants including two missense mutations, I219V, as in the PRCA-colon cancer patient, and V647M.	0.000271442	2006	MLH1	3	37012077	A	C,G
rs1800076	NA	1080	CFTR	umls:C0238339	CLINVAR	NA	0.121085767	NA	CFTR	7	117509093	G	A,T
rs1800080	20950468	11330	CTRC	umls:C0238339	BeFree	Mutation screening for coding regions of PRSS1, SPINK1, CFTR and the new hereditary pancreatitis-associated chymotrypsin C (CTRC) genes showed a novel variation, c.541A > G (p.S181G), in the exon 4 of PRSS1 gene and the classical CF p.F508del mutation in the CFTR.	0.241357209	2010	CFTR	7	117534330	A	G
rs1800080	20950468	1080	CFTR	umls:C0238339	BeFree	Mutation screening for coding regions of PRSS1, SPINK1, CFTR and the new hereditary pancreatitis-associated chymotrypsin C (CTRC) genes showed a novel variation, c.541A > G (p.S181G), in the exon 4 of PRSS1 gene and the classical CF p.F508del mutation in the CFTR.	0.121085767	2010	CFTR	7	117534330	A	G
rs1800080	20950468	5644	PRSS1	umls:C0238339	BeFree	Mutation screening for coding regions of PRSS1, SPINK1, CFTR and the new hereditary pancreatitis-associated chymotrypsin C (CTRC) genes showed a novel variation, c.541A > G (p.S181G), in the exon 4 of PRSS1 gene and the classical CF p.F508del mutation in the CFTR.	0.268229955	2010	CFTR	7	117534330	A	G
rs1800111	NA	1080	CFTR	umls:C0238339	CLINVAR	NA	0.121085767	NA	CFTR	7	117610521	G	C
rs193922659	NA	6690	SPINK1	umls:C0238339	CLINVAR	NA	0.244885954	NA	SPINK1	5	147831551	G	-
rs199422123	18511571	5644	PRSS1	umls:C0238339	BeFree	A novel A121T mutation in human cationic trypsinogen associated with hereditary pancreatitis: functional data indicating a loss-of-function mutation influencing the R122 trypsin cleavage site.	0.268229955	2008	PRSS1	7	142751934	G	A,T
rs199769221	10909845	5644	PRSS1	umls:C0238339	BeFree	Two heterozygous missense mutations, R122H (R117H) and N29I (N21I), in the cationic trypsinogen gene have been clearly associated with HP.	0.268229955	2000	PRSS1	7	142751920	G	A,C,T
rs199769221	10653140	5644	PRSS1	umls:C0238339	BeFree	However, neither the R117H nor the N21L mutation in the cationic trypsinogen were found in the HP family with the L327R alteration in CFTR.	0.268229955	2000	PRSS1	7	142751920	G	A,C,T
rs199769221	9557894	5644	PRSS1	umls:C0238339	BeFree	Recently, an arginine-histidine (R117H) mutation within the cationic trypsinogen gene was found in 5/5 families studied with HP.	0.268229955	1998	PRSS1	7	142751920	G	A,C,T
rs199769221	11138965	5644	PRSS1	umls:C0238339	BeFree	Three-point mutations (R117H, N211, A16V) within the cationic trypsinogen gene have been identified in patients with hereditary pancreatitis (HP).	0.268229955	2001	PRSS1	7	142751920	G	A,C,T
rs199769221	10208958	5644	PRSS1	umls:C0238339	BeFree	A family, in which 11 members had chronic pancreatitis, five had diabetes, and two had pancreatic cancer, was studied, and hereditary pancreatitis was diagnosed in all patients by demonstrating the mutation in exon 3 of the cationic trypsinogen gene (R117H).	0.268229955	1999	PRSS1	7	142751920	G	A,C,T
rs200678111	22942235	11330	CTRC	umls:C0238339	UNIPROT	Comprehensive functional analysis of chymotrypsin C (CTRC) variants reveals distinct loss-of-function mechanisms associated with pancreatitis risk.	0.241357209	2013	CTRC	1	15444645	A	G
rs202003805	16358943	5644	PRSS1	umls:C0238339	BeFree	The most common mutations in hereditary pancreatitis are R122H, N29I and A16V but many families have been described with clinically defined hereditary pancreatitis where there is no PRSS1 mutation.	0.268229955	2005	PRSS1	7	142750561	C	T
rs202003805	11260229	5644	PRSS1	umls:C0238339	BeFree	Among the known PRSS1 mutations, only the R122H was detected in a single subject and the A16V in two subjects in the cohort, strengthening that HP-associated PRSS1 mutations are rare in ICP.	0.268229955	2001	PRSS1	7	142750561	C	T
rs202003805	11138965	5644	PRSS1	umls:C0238339	BeFree	Three-point mutations (R117H, N211, A16V) within the cationic trypsinogen gene have been identified in patients with hereditary pancreatitis (HP).	0.268229955	2001	PRSS1	7	142750561	C	T
rs202058123	22942235	11330	CTRC	umls:C0238339	UNIPROT	Comprehensive functional analysis of chymotrypsin C (CTRC) variants reveals distinct loss-of-function mechanisms associated with pancreatitis risk.	0.241357209	2013	CTRC	1	15445606	G	A
rs267606982	15028953	5644	PRSS1	umls:C0238339	BeFree	Based on these findings, we revised the criteria for the diagnosis of HP; (1) recurrent acute or chronic pancreatitis with R122H or N29I mutation of the CT gene, or (2) recurrent acute or chronic pancreatitis with a family history of 2 or more affected patients, irrespective of generation, with at least 1 of the patients having no known etiological factors, and in case of siblings only, the onset of the disease in at least 1 of the patients is under age 40 years.	0.268229955	2004	NA	NA	NA	NA	NA
rs267606982	12508340	5644	PRSS1	umls:C0238339	BeFree	The majority of patients with hereditary pancreatitis express one of two mutations (R122H or N29I) in the cationic trypsinogen gene (PRSS1 gene).	0.268229955	2003	NA	NA	NA	NA	NA
rs267606982	10909845	5644	PRSS1	umls:C0238339	BeFree	Two heterozygous missense mutations, R122H (R117H) and N29I (N21I), in the cationic trypsinogen gene have been clearly associated with HP.	0.268229955	2000	NA	NA	NA	NA	NA
rs267606982	11874252	5644	PRSS1	umls:C0238339	BeFree	An R122H mutation in the cationic trypsinogen gene was identified in this patient, his brother, and his mother, indicating that they have hereditary pancreatitis.	0.268229955	2001	NA	NA	NA	NA	NA
rs267606982	11729110	5644	PRSS1	umls:C0238339	BeFree	Nine subjects had the N34S PSTI mutation and 1 had hereditary pancreatitis (R122H, PRSS1).	0.268229955	2001	NA	NA	NA	NA	NA
rs267606982	11866271	5644	PRSS1	umls:C0238339	BeFree	The R122H and N291 mutations of CT are the most common disease-associated mutations in HP; the N34S mutation of SPINK I is the most frequent genetic risk factor associated with IP.	0.268229955	2002	NA	NA	NA	NA	NA
rs267606982	11866271	6690	SPINK1	umls:C0238339	BeFree	The R122H and N291 mutations of CT are the most common disease-associated mutations in HP; the N34S mutation of SPINK I is the most frequent genetic risk factor associated with IP.	0.244885954	2002	NA	NA	NA	NA	NA
rs267606982	12408512	5644	PRSS1	umls:C0238339	BeFree	Ever since the discovery that in most patients with hereditary pancreatitis a mutation in the gene encoding for cationic trypsinogen (R122H) was found that results in a gain of trypsin function', many other mutations in the cationic trypsinogen gene, as well as in the gene encoding for pancreatic secretory trypsin inhibitor, have been found in patients with chronic pancreatitis.	0.268229955	2002	NA	NA	NA	NA	NA
rs267606982	11788572	5644	PRSS1	umls:C0238339	BeFree	Hereditary pancreatitis (HP) is usually caused by mutations in the cationic trypsinogen (PRSS1) gene, especially R122H or N29I.	0.268229955	2002	NA	NA	NA	NA	NA
rs267606982	12408512	6690	SPINK1	umls:C0238339	BeFree	Ever since the discovery that in most patients with hereditary pancreatitis a mutation in the gene encoding for cationic trypsinogen (R122H) was found that results in a gain of trypsin function', many other mutations in the cationic trypsinogen gene, as well as in the gene encoding for pancreatic secretory trypsin inhibitor, have been found in patients with chronic pancreatitis.	0.244885954	2002	NA	NA	NA	NA	NA
rs267606982	16358943	5644	PRSS1	umls:C0238339	BeFree	The most common mutations in hereditary pancreatitis are R122H, N29I and A16V but many families have been described with clinically defined hereditary pancreatitis where there is no PRSS1 mutation.	0.268229955	2005	NA	NA	NA	NA	NA
rs267606982	11702203	5644	PRSS1	umls:C0238339	BeFree	Since the identification in 1996 of a gain of function missense mutation, R122H, in the cationic trypsinogen gene (PRSS1) as a cause of hereditary pancreatitis, continued screening of this gene in both hereditary and sporadic pancreatitis has found more disease-associated missense mutations than expected.	0.268229955	2001	NA	NA	NA	NA	NA
rs267606982	11260229	5644	PRSS1	umls:C0238339	BeFree	Among the known PRSS1 mutations, only the R122H was detected in a single subject and the A16V in two subjects in the cohort, strengthening that HP-associated PRSS1 mutations are rare in ICP.	0.268229955	2001	NA	NA	NA	NA	NA
rs267606982	11932257	5644	PRSS1	umls:C0238339	BeFree	Finally, cathepsin B- catalyzed activation of recombinant human cationic trypsinogen with hereditary pancreatitis-associated mutations N29I, N29T, or R122H were characterized.	0.268229955	2002	NA	NA	NA	NA	NA
rs267606982	17069643	5644	PRSS1	umls:C0238339	BeFree	The R122H mutation of the cationic trypsinogen was found in patients with hereditary pancreatitis.	0.268229955	2006	NA	NA	NA	NA	NA
rs267606982	23474566	5644	PRSS1	umls:C0238339	BeFree	Hereditary pancreatitis is typically caused by the PRSS1 R122H or N29I mutations resulting in high penetrance (about 80%) autosomal dominant disorder that is usually reported in North America, Northern Europe and Northeast Asia, but not South America, Africa or India.	0.268229955	2013	NA	NA	NA	NA	NA
rs267606982	18702646	5644	PRSS1	umls:C0238339	BeFree	The R122H mutation represents the most common point mutation of the cationic trypsinogen gene (PRSS1) in patients with hereditary pancreatitis (HP; Online Mendelian inheritance in man [OMIM] 167800), a rare variety of chronic pancreatitis.	0.268229955	2008	NA	NA	NA	NA	NA
rs267606982	19287144	5644	PRSS1	umls:C0238339	BeFree	In 1996, shortly after a locus for hereditary pancreatitis had been mapped to chromosome 7q35, an apparent gain-of-function missense mutation, p.R122H, in the cationic trypsinogen gene (PRSS1) was identified.	0.268229955	2008	NA	NA	NA	NA	NA
rs34152967	11254448	60528	ELAC2	umls:C0238339	BeFree	Furthermore, only the two previously reported missense changes (Ser217Leu and Ala541Thr) were identified by mutational analysis of all HPC2/ELAC exons in 93 probands with HPC.	0.001357209	2001	NA	NA	NA	NA	NA
rs35831931	16963262	4292	MLH1	umls:C0238339	BeFree	Second, the samples from Finnish hereditary prostate cancer (HPC) families were used for the screening of MLH1 mutations which produced twelve MLH1 sequence variants including two missense mutations, I219V, as in the PRCA-colon cancer patient, and V647M.	0.000271442	2006	MLH1	3	37050528	G	A,T
rs35877720	12974284	6690	SPINK1	umls:C0238339	UNIPROT	Gene symbol: Spink1-Omim 167790. Disease: Hereditary pancreatitis.	0.244885954	2003	SPINK1	5	147831542	C	G
rs376907511	20950468	5644	PRSS1	umls:C0238339	BeFree	Mutation screening for coding regions of PRSS1, SPINK1, CFTR and the new hereditary pancreatitis-associated chymotrypsin C (CTRC) genes showed a novel variation, c.541A > G (p.S181G), in the exon 4 of PRSS1 gene and the classical CF p.F508del mutation in the CFTR.	0.268229955	2010	PRSS1	7	142752517	A	G
rs376907511	20950468	1080	CFTR	umls:C0238339	BeFree	Mutation screening for coding regions of PRSS1, SPINK1, CFTR and the new hereditary pancreatitis-associated chymotrypsin C (CTRC) genes showed a novel variation, c.541A > G (p.S181G), in the exon 4 of PRSS1 gene and the classical CF p.F508del mutation in the CFTR.	0.121085767	2010	PRSS1	7	142752517	A	G
rs376907511	20950468	11330	CTRC	umls:C0238339	BeFree	Mutation screening for coding regions of PRSS1, SPINK1, CFTR and the new hereditary pancreatitis-associated chymotrypsin C (CTRC) genes showed a novel variation, c.541A > G (p.S181G), in the exon 4 of PRSS1 gene and the classical CF p.F508del mutation in the CFTR.	0.241357209	2010	PRSS1	7	142752517	A	G
rs387906698	11842279	5644	PRSS1	umls:C0238339	BeFree	R116C mutation of cationic trypsinogen in a Turkish family with recurrent pancreatitis illustrates genetic microheterogeneity of hereditary pancreatitis.	0.268229955	2001	PRSS1	7	142751919	C	T
rs387906698	19191323	5644	PRSS1	umls:C0238339	BeFree	The results indicate that mutation-induced misfolding and intracellular retention of human cationic trypsinogen causes hereditary pancreatitis in carriers of the p.R116C mutation.	0.268229955	2009	PRSS1	7	142751919	C	T
rs4792311	11254448	60528	ELAC2	umls:C0238339	BeFree	Furthermore, only the two previously reported missense changes (Ser217Leu and Ala541Thr) were identified by mutational analysis of all HPC2/ELAC exons in 93 probands with HPC.	0.001357209	2001	ELAC2	17	13011692	G	A
rs515726206	NA	6690	SPINK1	umls:C0238339	CLINVAR	NA	0.244885954	NA	SPINK1	5	147828066	A	C
rs515726207	NA	6690	SPINK1	umls:C0238339	CLINVAR	NA	0.244885954	NA	SPINK1	5	147828056	A	G
rs515726208	NA	6690	SPINK1	umls:C0238339	CLINVAR	NA	0.244885954	NA	SPINK1	5	147824702	G	A
rs515726209	22942235	11330	CTRC	umls:C0238339	UNIPROT	Comprehensive functional analysis of chymotrypsin C (CTRC) variants reveals distinct loss-of-function mechanisms associated with pancreatitis risk.	0.241357209	2013	CTRC	1	15440577	G	A
rs515726209	NA	11330	CTRC	umls:C0238339	CLINVAR	NA	0.241357209	NA	CTRC	1	15440577	G	A
rs515726210	NA	11330	CTRC	umls:C0238339	CLINVAR	NA	0.241357209	NA	CTRC	1	15445695	CAAGAAGCCGGTAGTCTACACCCG	-
rs63750109	16963262	4292	MLH1	umls:C0238339	BeFree	Second, the samples from Finnish hereditary prostate cancer (HPC) families were used for the screening of MLH1 mutations which produced twelve MLH1 sequence variants including two missense mutations, I219V, as in the PRCA-colon cancer patient, and V647M.	0.000271442	2006	MLH1	3	37048559	G	A
rs75527207	NA	1080	CFTR	umls:C0238339	CLINVAR	NA	0.121085767	NA	CFTR	7	117587806	G	A
rs78655421	10653140	5644	PRSS1	umls:C0238339	BeFree	However, neither the R117H nor the N21L mutation in the cationic trypsinogen were found in the HP family with the L327R alteration in CFTR.	0.268229955	2000	CFTR	7	117530975	G	A,C,T

GWASdb Annotation(Total Genotypes:0)
(Waiting for update.)

GWASdb Snp Trait(Total Genotypes:0)
(Waiting for update.)

Mapped by lexical matching(Total Items:2)
HP ID	HP Name	MP ID	MP Name	Annotation
HP:0001738	Exocrine pancreatic insufficiency	MP:0014117	increased pancreatic beta cell apoptosis	increase in the number of pancreatic beta cells undergoing programmed cell death
HP:0011227	Elevated C-reactive protein level	MP:0008721	abnormal chemokine level	deviation from the normal levels of any of the class of pro-inflammatory cytokines that attract and activate leukocytes

Mapped by homologous gene(Total Items:14)
HP ID	HP Name	MP ID	MP Name	Annotation
HP:0005213	Pancreatic calcification	MP:0014233	bile duct epithelium hyperplasia
HP:0001733	Pancreatitis	MP:0020134	abnormal gallbladder size	an anomaly in the size of the gall bladder compared to average, the organ that serves as a storage reservoir for bile
HP:0001945	Fever	MP:0020254	decreased collagen level	decreased level of the main structural protein of the various connective tissues in animals
HP:0001738	Exocrine pancreatic insufficiency	MP:0014233	bile duct epithelium hyperplasia
HP:0002202	Pleural effusion	MP:0014233	bile duct epithelium hyperplasia
HP:0001977	Abnormal thrombosis	MP:0014233	bile duct epithelium hyperplasia
HP:0005206	Pancreatic pseudocyst	MP:0014233	bile duct epithelium hyperplasia
HP:0002027	Abdominal pain	MP:0020220	decreased tear production	decreased production of the amount of fluid produced in the eye
HP:0000819	Diabetes mellitus	MP:0020137	decreased bone mineralization	decrease in the rate at which minerals are deposited into bone
HP:0000952	Jaundice	MP:0020215	impaired blood coagulation	impaired ability of the blood to clot
HP:0001974	Leukocytosis	MP:0020154	impaired humoral immune response	impaired response of the immune system that mediates secreted antibodies produced in B cells
HP:0002570	Steatorrhea	MP:0020137	decreased bone mineralization	decrease in the rate at which minerals are deposited into bone
HP:0100027	Recurrent pancreatitis	MP:0012118	absent trophectoderm cell proliferation
HP:0011227	Elevated C-reactive protein level	MP:0008721	abnormal chemokine level	deviation from the normal levels of any of the class of pro-inflammatory cytokines that attract and activate leukocytes

Disease ID	844
Disease	hereditary chronic pancreatitis
Case	(Waiting for update.)